iTRAQ-based Quantitative Proteomics Analysis Identifies Host Pathways Modulated during Toxoplasma gondii Infection in Swine.

Toxoplasma gondii is a leading cause of foodborne illness and consumption of undercooked pig meat is a major risk factor for acquiring toxoplasmosis, which causes a substantial burden on society. Here, we used isobaric tags for relative and absolute quantification (iTRAQ) labelling coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS) to identify cellular proteins and pathways altered during T. gondii infection in pigs. We also used parallel reaction monitoring-based LC-MS/MS to verify the levels of protein expression of infected spleens and mesenteric lymph nodes (MLNs). At 6 days post-infection (dpi), 156, 391, 170, 292, and 200 differentially expressed proteins (DEPs) were detected in the brain, liver, lung, MLNs and spleen, respectively.

At 18 dpi, 339, 351, 483, 388, and 303 DEPs were detected in the brain, liver, lung, MLNs and spleen, respectively. Although proteins involved in immune responses were upregulated in all infected tissues, protein expression signature in infected livers was dominated by downregulation of the metabolic processes.

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

DLR-bACE1-Mu-48T 48T
EUR 489
  • Should the Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, tissue homogenates, cerebrospinal fluid or other biological fluids.

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

DLR-bACE1-Mu-96T 96T
EUR 635
  • Should the Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, tissue homogenates, cerebrospinal fluid or other biological fluids.

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

DLR-bACE1-Ra-48T 48T
EUR 508
  • Should the Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

DLR-bACE1-Ra-96T 96T
EUR 661
  • Should the Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Hu-48Tests 48 Tests
EUR 500

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Hu-96Tests 96 Tests
EUR 692

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Mu-48Tests 48 Tests
EUR 511

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Mu-96Tests 96 Tests
EUR 709

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Ra-48Tests 48 Tests
EUR 534

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RDR-bACE1-Ra-96Tests 96 Tests
EUR 742

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Hu-48Tests 48 Tests
EUR 478

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Hu-96Tests 96 Tests
EUR 662

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Mu-48Tests 48 Tests
EUR 489

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Mu-96Tests 96 Tests
EUR 677

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Ra-48Tests 48 Tests
EUR 511

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

RD-bACE1-Ra-96Tests 96 Tests
EUR 709

Bace1/ Rat Bace1 ELISA Kit

ELI-02505r 96 Tests
EUR 886

BACE1

RA21010 50 ug
EUR 435

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human BACE1 ELISA Kit

EHB0322 96Tests
EUR 521

Human BACE1 ELISA Kit

ELA-E0718h 96 Tests
EUR 824

Goat BACE1 ELISA Kit

EGTB0322 96Tests
EUR 521

Bovine BACE1 ELISA Kit

EBB0322 96Tests
EUR 521

Canine BACE1 ELISA Kit

ECB0322 96Tests
EUR 521

Chicken BACE1 ELISA Kit

ECKB0322 96Tests
EUR 521

Anserini bACE1 ELISA Kit

EAB0322 96Tests
EUR 521

BACE1 ELISA KIT|Human

EF006629 96 Tests
EUR 689

Mouse bACE1 ELISA Kit

EMB0322 96Tests
EUR 521

Rat BACE1 ELISA Kit

ERB0322 96Tests
EUR 521

Sheep BACE1 ELISA Kit

ESB0322 96Tests
EUR 521

Rabbit BACE1 ELISA Kit

ERTB0322 96Tests
EUR 521

Monkey BACE1 ELISA Kit

EMKB0322 96Tests
EUR 521

Porcine BACE1 ELISA Kit

EPB0322 96Tests
EUR 521

BACE1 antibody

20R-BR014 50 ug
EUR 656
Description: Rabbit polyclonal BACE1 antibody

BACE1 antibody

20R-BR015 50 ug
EUR 656
Description: Rabbit polyclonal BACE1 antibody

BACE1 Antibody

6651-100
EUR 349

BACE1 Antibody

6651-30T
EUR 146

BACE1 antibody

70R-15953 50 ul
EUR 435
Description: Rabbit polyclonal BACE1 antibody

BACE1 Antibody

35650-100ul 100ul
EUR 252

BACE1 Antibody

1-CSB-PA002524GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BACE1 Antibody

1-CSB-PA002524LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

BACE1 Antibody

DF7939 200ul
EUR 304
Description: BACE1 Antibody detects endogenous levels of total BACE1.

BACE1 Antibody

1-CSB-PA150463
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

BACE1 Antibody

1-CSB-PA173556
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

BACE1 antibody

70R-7276 50 ug
EUR 467
Description: Rabbit polyclonal BACE1 antibody raised against the N terminal of BACE1

Bace1 antibody

70R-8662 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Bace1 antibody

BACE1 protein

E62B011 20ug
EUR 343

BACE1 Antibody

1-CSB-PA008418
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

bACE1 siRNA

20-abx900582
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

bACE1 siRNA

20-abx908826
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

bACE1 siRNA

20-abx908827
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BACE1 Antibody

ABD7939 100 ug
EUR 438

BACE1 Antibody

ABD7999 100 ug
EUR 438

anti-BACE1

YF-PA17994 100 ug
EUR 403
Description: Rabbit polyclonal to BACE1

Guinea Pig BACE1 ELISA Kit

EGB0322 96Tests
EUR 521

BACE1 ELISA Kit (Human) (OKAN05558)

OKAN05558 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

BACE1 ELISA Kit (Mouse) (OKAN05559)

OKAN05559 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 14.1 pg/mL

BACE1 ELISA Kit (Rat) (OKCD02313)

OKCD02313 96 Wells
EUR 818
Description: Description of target: Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

BACE1 ELISA Kit (Human) (OKCD06723)

OKCD06723 96 Wells
EUR 753
Description: Description of target: Cerebral deposition of amyloid beta peptide is an early and critical feature of Alzheimer's disease. Amyloid beta peptide is generated by proteolytic cleavage of amyloid precursor protein (APP) by two proteases, one of which is the protein. BACE1, a member of the peptidase A1 protein family, is a type I integral membrane glycoprotein and aspartic protease that is found mainly in the Golgi.Cerebral deposition of amyloid beta peptide is an early and critical feature of Alzheimer's disease. Amyloid beta peptide is generated by proteolytic cleavage of amyloid precursor protein (APP) by two proteases, one of which is the protein encoded by this gene. The encoded protein, a member of the peptidase A1 protein family, is a type I integral membrane glycoprotein and aspartic protease that is found mainly in the Golgi. Four transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.11ng/mL

BACE1 ELISA Kit (Mouse) (OKCD06724)

OKCD06724 96 Wells
EUR 779
Description: Description of target: Bace1 is responsible for the proteolytic processing of the amyloid precursor protein (APP). Bace1 cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.1pg/mL

BACE1 ELISA Kit (Mouse) (OKEH03206)

OKEH03206 96 Wells
EUR 662
Description: Description of target: Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 ng/mL

BACE1 Blocking Peptide

33R-3496 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BACE1 antibody, catalog no. 70R-7276

Polyclonal BACE1 Antibody

APG03188G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 . This antibody is tested and proven to work in the following applications:

BACE1 Blocking Peptide

DF7939-BP 1mg
EUR 195

bACE1 (pS498) Antibody

abx148520-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

BACE1 Conjugated Antibody

C35650 100ul
EUR 397

BACE1 cloning plasmid

CSB-CL002524HU-10ug 10ug
EUR 531
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggcccaagccctgccctggctcctgctgtggatgggcgcgggagtgctgcctgcccacggcacccagcacggcatccggctgcccctgcgcagcggcctggggggcgcccccctggggctgcggctgccccgggagaccgacgaagagcccgaggagcccggccggaggggca
  • Show more
Description: A cloning plasmid for the BACE1 gene.

BACE1 Polyclonal Antibody

ABP-PAB-31005 50 ug Ask for price
    • Product line: Proteases
    • Brand:

BACE1 Polyclonal Antibody

ABP-PAB-31006 50 ug Ask for price
    • Product line: Proteases
    • Brand:

BACE1 Rabbit pAb

A5266-100ul 100 ul
EUR 308

BACE1 Rabbit pAb

A5266-200ul 200 ul
EUR 459

BACE1 Rabbit pAb

A5266-20ul 20 ul
EUR 183

BACE1 Rabbit pAb

A5266-50ul 50 ul
EUR 223

BACE1-IN-1

HY-100182 5mg
EUR 2465

anti- BACE1 antibody

FNab00781 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC: 1:100-1:400
  • Immunogen: beta-site APP-cleaving enzyme 1
  • Uniprot ID: P56817
  • Gene ID: 23621
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against BACE1

Anti-BACE1 antibody

PAab00781 100 ug
EUR 386

Recombinant Human BACE1

P0562 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P56817
Description: Recombinant Human protein for BACE1

Anti-BACE1 antibody

STJ29911 100 µl
EUR 277
Description: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients.

Anti-BACE1 Antibody

STJ193186 200 µl
EUR 197

BACE1 Antibody, HRP conjugated

1-CSB-PA002524LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BACE1 Antibody, FITC conjugated

1-CSB-PA002524LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BACE1 Antibody, Biotin conjugated

1-CSB-PA002524LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse BACE1 shRNA Plasmid

20-abx973511
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat BACE1 shRNA Plasmid

20-abx985469
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BACE1 shRNA Plasmid

20-abx958402
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BACE1 recombinant monoclonal antibody

A5095 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human BACE1 for WB,ELISA

BACE1 Recombinant Protein (Human)

RP002572 100 ug Ask for price

BACE1 Recombinant Protein (Mouse)

RP118622 100 ug Ask for price

BACE1 Recombinant Protein (Mouse)

RP118625 100 ug Ask for price

BACE1 Recombinant Protein (Rat)

RP191804 100 ug Ask for price

Rat Bace1/ Beta-secretase 1 ELISA Kit

E0115Ra 1 Kit
EUR 571

Mouse Bace1/ Beta-secretase 1 ELISA Kit

E0159Mo 1 Kit
EUR 571

Human BACE1/ Beta-secretase 1 ELISA Kit

E0249Hu 1 Kit
EUR 571

Mouse Beta- secretase 1, Bace1 ELISA KIT

ELI-02502m 96 Tests
EUR 865

Human Beta- secretase 1, BACE1 ELISA KIT

ELI-02503h 96 Tests
EUR 824

Bovine Beta- secretase 1, BACE1 ELISA KIT

ELI-02504b 96 Tests
EUR 928

Mouse Bace1(Beta-secretase 1) ELISA Kit

EM0448 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P56818
  • Alias: Bace1/APP beta-secretase/ASP2/Aspartyl protease 2/BACEAsp 2/beta-secretase 1/beta-secretase 1 precursor variant 1/beta-site amyloid beta A4 precursor protein-cleaving enzyme/Beta-site amyloid
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

BACE1 ELISA Kit (Human) : 96 Wells (OKEH00554)

OKEH00554 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. [provided by RefSeq, Nov 2015];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL

Polyclonal BACE1 Antibody (N-term)

APG03026G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Bace1 antibody - middle region

APG03189G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Bace1 - middle region. This antibody is tested and proven to work in the following applications:

Monoclonal BACE1 Antibody, Clone: 3C1C3

APR15123G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human BACE1. The antibodies are raised in Mouse and are from clone 3C1C3. This antibody is applicable in WB, FC, ICC, E

Polyclonal BACE1 / BACE Antibody (Internal)

APR11484G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 / BACE (Internal). This antibody is tested and proven to work in the following applications:

Bace1 ORF Vector (Rat) (pORF)

ORF063936 1.0 ug DNA
EUR 506

BACE1 ORF Vector (Human) (pORF)

ORF000858 1.0 ug DNA
EUR 95

Bace1 ORF Vector (Mouse) (pORF)

ORF039542 1.0 ug DNA
EUR 506

Bace1 ORF Vector (Mouse) (pORF)

ORF039543 1.0 ug DNA
EUR 506

Recombinant Human BACE1/ASP2 Protein

RP00165 20 μg
EUR 183

Bace1 ELISA Kit| Mouse Beta-secretase 1 ELISA Kit

EF013095 96 Tests
EUR 689

Human CellExp? BACE1, human recombinant (Native)

7398-10
EUR 300

Human CellExp? BACE1, human recombinant (Native)

7398-50
EUR 827

Polyclonal BACE1 / BACE Antibody (C-Terminus)

AMM05613G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 / BACE (C-Terminus). This antibody is tested and proven to work in the following applications:

Bace1 sgRNA CRISPR Lentivector set (Mouse)

K5021101 3 x 1.0 ug
EUR 339

Bace1 sgRNA CRISPR Lentivector set (Rat)

K6778001 3 x 1.0 ug
EUR 339

BACE1 sgRNA CRISPR Lentivector set (Human)

K0166201 3 x 1.0 ug
EUR 339

?-Secretase (BACE1) Activity Assay Kit (Fluorometric)

K388-100
EUR 604

Anti-BACE1/Bace Rabbit Monoclonal Antibody

M00322 100ug/vial
EUR 397
Description: Rabbit Monoclonal BACE1/Bace Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

BACE1-AS ORF Vector (Human) (pORF)

ORF016079 1.0 ug DNA Ask for price

Mouse Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

20-abx153699
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

20-abx155244
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

20-abx150780
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx254802-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx256725-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx252065-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human BACE1(Beta-site APP Cleaving Enzyme 1) ELISA Kit

EH2687 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P56817
  • Alias: BACE1/APP beta-secretase/ASP2/Aspartyl protease 2/BACEAsp 2/beta-secretase 1/beta-secretase 1 precursor variant 1/beta-site amyloid beta A4 precursor protein-cleaving enzyme/Beta-site amyloid
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human β-site APP-Cleaving Enzyme 1, BACE1 ELISA kit

CSB-E09824h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human β-site APP-Cleaving Enzyme 1, BACE1 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human β-site APP-Cleaving Enzyme 1, BACE1 ELISA kit

1-CSB-E09824h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human β-site APP-Cleaving Enzyme 1, BACE1 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx359493-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx361238-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx362709-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx353523-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Chicken Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx356484-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx574903-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Cow Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit

abx513826-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat BACE1(Beta Site APP Cleaving Enzyme 1) ELISA Kit

ER0756 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P56819
  • Alias: BACE1/APP beta-secretase/ASP2/Aspartyl protease 2/BACEAsp 2/beta-secretase 1/beta-secretase 1 precursor variant 1/beta-site amyloid beta A4 precursor protein-cleaving enzyme/Beta-site amyloid
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Beta-Site APP Cleaving Enzyme 1(bACE1)ELISA Kit

QY-E10384 96T
EUR 361

Human Beta-Site APP Cleaving Enzyme 1 ELISA Kit (bACE1)

RK00963 96 Tests
EUR 521

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

SEA718Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

SEA718Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

SEA718Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit

SEA718Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) in serum, plasma, cerebrospinal fluid and other biological fluids.

By weighted gene co-expression network analysis, we could further show that all proteins were clustered into 25 co-expression modules and that the pink module significantly correlated with the infection status. We also identified 163 potential anti-T. gondii proteins (PATPs) and provided evidence that two PATPs (HSP70.2 and PDIA3) can reduce T.

gondii burden in porcine macrophages in vitro. This comprehensive proteomics analysis reveals new facets in the pathogenesis of T. gondii infection and identifies key proteins that may contribute to the pig’s defense against this infection.