iTRAQ-based Quantitative Proteomics Analysis Identifies Host Pathways Modulated during Toxoplasma gondii Infection in Swine.

Toxoplasma gondii is a leading cause of foodborne illness and consumption of undercooked pig meat is a major risk factor for acquiring toxoplasmosis, which causes a substantial burden on society. Here, we used isobaric tags for relative and absolute quantification (iTRAQ) labelling coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS) to identify cellular proteins and pathways altered during T. gondii infection in pigs. We also used parallel reaction monitoring-based LC-MS/MS to verify the levels of protein expression of infected spleens and mesenteric lymph nodes (MLNs). At 6 days post-infection (dpi), 156, 391, 170, 292, and 200 differentially expressed proteins (DEPs) were detected in the brain, liver, lung, MLNs and spleen, respectively.

At 18 dpi, 339, 351, 483, 388, and 303 DEPs were detected in the brain, liver, lung, MLNs and spleen, respectively. Although proteins involved in immune responses were upregulated in all infected tissues, protein expression signature in infected livers was dominated by downregulation of the metabolic processes.

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
DLR-bACE1-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, tissue homogenates, cerebrospinal fluid or other biological fluids.

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
DLR-bACE1-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, tissue homogenates, cerebrospinal fluid or other biological fluids.

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
DLR-bACE1-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
DLR-bACE1-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RDR-bACE1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RDR-bACE1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RDR-bACE1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RDR-bACE1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RDR-bACE1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RDR-bACE1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RD-bACE1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RD-bACE1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RD-bACE1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RD-bACE1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RD-bACE1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
RD-bACE1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Bace1/ Rat Bace1 ELISA Kit
ELI-02505r	Lifescience Market	96 Tests	EUR 886

BACE1
RA21010	Neuromics	50 ug	EUR 435

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human BACE1 ELISA Kit
EHB0322	Abclonal	96Tests	EUR 521

Human BACE1 ELISA Kit
ELA-E0718h	Lifescience Market	96 Tests	EUR 824

Goat BACE1 ELISA Kit
EGTB0322	Abclonal	96Tests	EUR 521

Bovine BACE1 ELISA Kit
EBB0322	Abclonal	96Tests	EUR 521

Canine BACE1 ELISA Kit
ECB0322	Abclonal	96Tests	EUR 521

Chicken BACE1 ELISA Kit
ECKB0322	Abclonal	96Tests	EUR 521

Anserini bACE1 ELISA Kit
EAB0322	Abclonal	96Tests	EUR 521

BACE1 ELISA KIT|Human
EF006629	Lifescience Market	96 Tests	EUR 689

Mouse bACE1 ELISA Kit
EMB0322	Abclonal	96Tests	EUR 521

Rat BACE1 ELISA Kit
ERB0322	Abclonal	96Tests	EUR 521

Sheep BACE1 ELISA Kit
ESB0322	Abclonal	96Tests	EUR 521

Rabbit BACE1 ELISA Kit
ERTB0322	Abclonal	96Tests	EUR 521

Monkey BACE1 ELISA Kit
EMKB0322	Abclonal	96Tests	EUR 521

Porcine BACE1 ELISA Kit
EPB0322	Abclonal	96Tests	EUR 521

BACE1 antibody
20R-BR014	Fitzgerald	50 ug	EUR 656
Description: Rabbit polyclonal BACE1 antibody

BACE1 antibody
20R-BR015	Fitzgerald	50 ug	EUR 656
Description: Rabbit polyclonal BACE1 antibody

BACE1 Antibody
6651-100	Biovision		EUR 349

BACE1 Antibody
6651-30T	Biovision		EUR 146

BACE1 antibody
70R-15953	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal BACE1 antibody

BACE1 Antibody
35650-100ul	SAB	100ul	EUR 252

BACE1 Antibody
1-CSB-PA002524GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BACE1 Antibody
1-CSB-PA002524LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

BACE1 Antibody
DF7939	Affbiotech	200ul	EUR 304
Description: BACE1 Antibody detects endogenous levels of total BACE1.

BACE1 Antibody
1-CSB-PA150463	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

BACE1 Antibody
1-CSB-PA173556	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

BACE1 antibody
70R-7276	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal BACE1 antibody raised against the N terminal of BACE1

Bace1 antibody
70R-8662	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Bace1 antibody

BACE1 protein
E62B011	EnoGene	20ug	EUR 343

BACE1 Antibody
1-CSB-PA008418	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

bACE1 siRNA
20-abx900582	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

bACE1 siRNA
20-abx908826	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

bACE1 siRNA
20-abx908827	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BACE1 Antibody
ABD7939	Lifescience Market	100 ug	EUR 438

BACE1 Antibody
ABD7999	Lifescience Market	100 ug	EUR 438

anti-BACE1
YF-PA17994	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to BACE1

Guinea Pig BACE1 ELISA Kit
EGB0322	Abclonal	96Tests	EUR 521

BACE1 ELISA Kit (Human) (OKAN05558)
OKAN05558	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

BACE1 ELISA Kit (Mouse) (OKAN05559)
OKAN05559	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 14.1 pg/mL

BACE1 ELISA Kit (Rat) (OKCD02313)
OKCD02313	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

BACE1 ELISA Kit (Human) (OKCD06723)
OKCD06723	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: Cerebral deposition of amyloid beta peptide is an early and critical feature of Alzheimer's disease. Amyloid beta peptide is generated by proteolytic cleavage of amyloid precursor protein (APP) by two proteases, one of which is the protein. BACE1, a member of the peptidase A1 protein family, is a type I integral membrane glycoprotein and aspartic protease that is found mainly in the Golgi.Cerebral deposition of amyloid beta peptide is an early and critical feature of Alzheimer's disease. Amyloid beta peptide is generated by proteolytic cleavage of amyloid precursor protein (APP) by two proteases, one of which is the protein encoded by this gene. The encoded protein, a member of the peptidase A1 protein family, is a type I integral membrane glycoprotein and aspartic protease that is found mainly in the Golgi. Four transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.11ng/mL

BACE1 ELISA Kit (Mouse) (OKCD06724)
OKCD06724	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Bace1 is responsible for the proteolytic processing of the amyloid precursor protein (APP). Bace1 cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.1pg/mL

BACE1 ELISA Kit (Mouse) (OKEH03206)
OKEH03206	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves at the N-terminus of the A-beta peptide sequence, between residues 671 and 672 of APP, leads to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 ng/mL

BACE1 Blocking Peptide
33R-3496	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BACE1 antibody, catalog no. 70R-7276

Polyclonal BACE1 Antibody
APG03188G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 . This antibody is tested and proven to work in the following applications:

BACE1 Blocking Peptide
DF7939-BP	Affbiotech	1mg	EUR 195

bACE1 (pS498) Antibody
abx148520-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

BACE1 Conjugated Antibody
C35650	SAB	100ul	EUR 397

BACE1 cloning plasmid
CSB-CL002524HU-10ug	Cusabio	10ug	EUR 531
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1506 Sequence: atggcccaagccctgccctggctcctgctgtggatgggcgcgggagtgctgcctgcccacggcacccagcacggcatccggctgcccctgcgcagcggcctggggggcgcccccctggggctgcggctgccccgggagaccgacgaagagcccgaggagcccggccggaggggca Show more
Description: A cloning plasmid for the BACE1 gene.

BACE1 Polyclonal Antibody
ABP-PAB-31005	Allele Biotech	50 ug	Ask for price
Product line: Proteases Brand:

BACE1 Polyclonal Antibody
ABP-PAB-31006	Allele Biotech	50 ug	Ask for price
Product line: Proteases Brand:

BACE1 Rabbit pAb
A5266-100ul	Abclonal	100 ul	EUR 308

BACE1 Rabbit pAb
A5266-200ul	Abclonal	200 ul	EUR 459

BACE1 Rabbit pAb
A5266-20ul	Abclonal	20 ul	EUR 183

BACE1 Rabbit pAb
A5266-50ul	Abclonal	50 ul	EUR 223

BACE1-IN-1
HY-100182	MedChemExpress	5mg	EUR 2465

anti- BACE1 antibody
FNab00781	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:100-1:400 Immunogen: beta-site APP-cleaving enzyme 1 Uniprot ID: P56817 Gene ID: 23621 Research Area: Neuroscience, Metabolism
Description: Antibody raised against BACE1

Anti-BACE1 antibody
PAab00781	Lifescience Market	100 ug	EUR 386

Recombinant Human BACE1
P0562	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P56817
Description: Recombinant Human protein for BACE1

Anti-BACE1 antibody
STJ29911	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients.

Anti-BACE1 Antibody
STJ193186	St John's Laboratory	200 µl	EUR 197

BACE1 Antibody, HRP conjugated
1-CSB-PA002524LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BACE1 Antibody, FITC conjugated
1-CSB-PA002524LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BACE1 Antibody, Biotin conjugated
1-CSB-PA002524LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BACE1. Recognizes BACE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse BACE1 shRNA Plasmid
20-abx973511	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat BACE1 shRNA Plasmid
20-abx985469	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human BACE1 shRNA Plasmid
20-abx958402	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BACE1 recombinant monoclonal antibody
A5095	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human BACE1 for WB,ELISA

BACE1 Recombinant Protein (Human)
RP002572	ABM	100 ug	Ask for price

BACE1 Recombinant Protein (Mouse)
RP118622	ABM	100 ug	Ask for price

BACE1 Recombinant Protein (Mouse)
RP118625	ABM	100 ug	Ask for price

BACE1 Recombinant Protein (Rat)
RP191804	ABM	100 ug	Ask for price

Rat Bace1/ Beta-secretase 1 ELISA Kit
E0115Ra	Sunlong	1 Kit	EUR 571

Mouse Bace1/ Beta-secretase 1 ELISA Kit
E0159Mo	Sunlong	1 Kit	EUR 571

Human BACE1/ Beta-secretase 1 ELISA Kit
E0249Hu	Sunlong	1 Kit	EUR 571

Mouse Beta- secretase 1, Bace1 ELISA KIT
ELI-02502m	Lifescience Market	96 Tests	EUR 865

Human Beta- secretase 1, BACE1 ELISA KIT
ELI-02503h	Lifescience Market	96 Tests	EUR 824

Bovine Beta- secretase 1, BACE1 ELISA KIT
ELI-02504b	Lifescience Market	96 Tests	EUR 928

Mouse Bace1(Beta-secretase 1) ELISA Kit
EM0448	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P56818 Alias: Bace1/APP beta-secretase/ASP2/Aspartyl protease 2/BACEAsp 2/beta-secretase 1/beta-secretase 1 precursor variant 1/beta-site amyloid beta A4 precursor protein-cleaving enzyme/Beta-site amyloid Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

BACE1 ELISA Kit (Human) : 96 Wells (OKEH00554)
OKEH00554	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. [provided by RefSeq, Nov 2015];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL

Polyclonal BACE1 Antibody (N-term)
APG03026G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Bace1 antibody - middle region
APG03189G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Bace1 - middle region. This antibody is tested and proven to work in the following applications:

Monoclonal BACE1 Antibody, Clone: 3C1C3
APR15123G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human BACE1. The antibodies are raised in Mouse and are from clone 3C1C3. This antibody is applicable in WB, FC, ICC, E

Polyclonal BACE1 / BACE Antibody (Internal)
APR11484G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 / BACE (Internal). This antibody is tested and proven to work in the following applications:

Bace1 ORF Vector (Rat) (pORF)
ORF063936	ABM	1.0 ug DNA	EUR 506

BACE1 ORF Vector (Human) (pORF)
ORF000858	ABM	1.0 ug DNA	EUR 95

Bace1 ORF Vector (Mouse) (pORF)
ORF039542	ABM	1.0 ug DNA	EUR 506

Bace1 ORF Vector (Mouse) (pORF)
ORF039543	ABM	1.0 ug DNA	EUR 506

Recombinant Human BACE1/ASP2 Protein
RP00165	Abclonal	20 μg	EUR 183

Bace1 ELISA Kit| Mouse Beta-secretase 1 ELISA Kit
EF013095	Lifescience Market	96 Tests	EUR 689

Human CellExp? BACE1, human recombinant (Native)
7398-10	Biovision		EUR 300

Human CellExp? BACE1, human recombinant (Native)
7398-50	Biovision		EUR 827

Polyclonal BACE1 / BACE Antibody (C-Terminus)
AMM05613G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BACE1 / BACE (C-Terminus). This antibody is tested and proven to work in the following applications:

Bace1 sgRNA CRISPR Lentivector set (Mouse)
K5021101	ABM	3 x 1.0 ug	EUR 339

Bace1 sgRNA CRISPR Lentivector set (Rat)
K6778001	ABM	3 x 1.0 ug	EUR 339

BACE1 sgRNA CRISPR Lentivector set (Human)
K0166201	ABM	3 x 1.0 ug	EUR 339

?-Secretase (BACE1) Activity Assay Kit (Fluorometric)
K388-100	Biovision		EUR 604

Anti-BACE1/Bace Rabbit Monoclonal Antibody
M00322	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal BACE1/Bace Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

BACE1-AS ORF Vector (Human) (pORF)
ORF016079	ABM	1.0 ug DNA	Ask for price

Mouse Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
20-abx153699	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
20-abx155244	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
20-abx150780	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx254802-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx256725-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx252065-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human BACE1(Beta-site APP Cleaving Enzyme 1) ELISA Kit
EH2687	FN Test	96T	EUR 524.1
Detection range: 0.625-40 ng/ml Uniprot ID: P56817 Alias: BACE1/APP beta-secretase/ASP2/Aspartyl protease 2/BACEAsp 2/beta-secretase 1/beta-secretase 1 precursor variant 1/beta-site amyloid beta A4 precursor protein-cleaving enzyme/Beta-site amyloid Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human β-site APP-Cleaving Enzyme 1, BACE1 ELISA kit
CSB-E09824h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human β-site APP-Cleaving Enzyme 1, BACE1 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human β-site APP-Cleaving Enzyme 1, BACE1 ELISA kit
1-CSB-E09824h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human β-site APP-Cleaving Enzyme 1, BACE1 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx359493-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx361238-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx362709-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx353523-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Chicken Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx356484-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx574903-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Cow Beta-Site APP Cleaving Enzyme 1 (BACE1) ELISA Kit
abx513826-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat BACE1(Beta Site APP Cleaving Enzyme 1) ELISA Kit
ER0756	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P56819 Alias: BACE1/APP beta-secretase/ASP2/Aspartyl protease 2/BACEAsp 2/beta-secretase 1/beta-secretase 1 precursor variant 1/beta-site amyloid beta A4 precursor protein-cleaving enzyme/Beta-site amyloid Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Beta-Site APP Cleaving Enzyme 1(bACE1)ELISA Kit
QY-E10384	Qayee Biotechnology	96T	EUR 361

Human Beta-Site APP Cleaving Enzyme 1 ELISA Kit (bACE1)
RK00963	Abclonal	96 Tests	EUR 521

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
SEA718Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
SEA718Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
SEA718Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Beta-Site APP Cleaving Enzyme 1 (bACE1) ELISA Kit
SEA718Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Beta-Site APP Cleaving Enzyme 1 (bACE1) in serum, plasma, cerebrospinal fluid and other biological fluids.

By weighted gene co-expression network analysis, we could further show that all proteins were clustered into 25 co-expression modules and that the pink module significantly correlated with the infection status. We also identified 163 potential anti-T. gondii proteins (PATPs) and provided evidence that two PATPs (HSP70.2 and PDIA3) can reduce T.

gondii burden in porcine macrophages in vitro. This comprehensive proteomics analysis reveals new facets in the pathogenesis of T. gondii infection and identifies key proteins that may contribute to the pig’s defense against this infection.