Circulating Protein Signatures and Causal Candidates for Type 2 Diabetes.

The increasing prevalence of type 2 diabetes poses a major challenge to societies worldwide. Blood-based factors like serum proteins are in contact with every organ in the body to mediate global homeostasis and may thus directly regulate complex processes such as aging and the development of common chronic diseases. We applied a data-driven proteomics approach, measuring serum levels of 4,137 proteins in 5,438 elderly Icelanders and identified 536 proteins associated with prevalent and/or incident type 2 diabetes. We validated a subset of the observed associations in an independent case-control study of type 2 diabetes.

Mouse Apolipoprotein E (APOE) ELISA Kit
DLR-APOE-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Apolipoprotein E (APOE) ELISA Kit
DLR-APOE-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Apolipoprotein E (APOE) ELISA Kit
DLR-APOE-p-48T	DL Develop	48T	EUR 547
Should the Porcine Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Porcine Apolipoprotein E (APOE) ELISA Kit
DLR-APOE-p-96T	DL Develop	96T	EUR 715
Should the Porcine Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Rat Apolipoprotein E (APOE) ELISA Kit
DLR-APOE-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein E (APOE) ELISA Kit
DLR-APOE-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit
DLR-APOE-Rb-48T	DL Develop	48T	EUR 508
Should the Rabbit Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rabbit Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit
DLR-APOE-Rb-96T	DL Develop	96T	EUR 661
Should the Rabbit Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rabbit Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein E (APOE) ELISA Kit
RD-APOE-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Apolipoprotein E (APOE) ELISA Kit
RD-APOE-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Mouse Apolipoprotein E (APOE) ELISA Kit
RD-APOE-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Apolipoprotein E (APOE) ELISA Kit
RD-APOE-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Porcine Apolipoprotein E (APOE) ELISA Kit
RD-APOE-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine Apolipoprotein E (APOE) ELISA Kit
RD-APOE-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat Apolipoprotein E (APOE) ELISA Kit
RD-APOE-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Apolipoprotein E (APOE) ELISA Kit
RD-APOE-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Rabbit Apolipoprotein E (APOE) ELISA Kit
RD-APOE-Rb-48Tests	Reddot Biotech	48 Tests	EUR 511

Rabbit Apolipoprotein E (APOE) ELISA Kit
RD-APOE-Rb-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-Hu-48Tests	Reddot Biotech	48 Tests	EUR 455

Human Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-Hu-96Tests	Reddot Biotech	96 Tests	EUR 629

Mouse Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Porcine Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Rabbit Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-Rb-48Tests	Reddot Biotech	48 Tests	EUR 534

Rabbit Apolipoprotein E (APOE) ELISA Kit
RDR-APOE-Rb-96Tests	Reddot Biotech	96 Tests	EUR 742

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

APOE
E62B009	EnoGene	20ug	EUR 382

ApoE
MO25042	Neuromics	100 ul	EUR 474

Human APOE ELISA Kit
EHA0526	Abclonal	96Tests	EUR 521

Human APOE ELISA Kit
ELA-E0704h	Lifescience Market	96 Tests	EUR 824

Goat APOE ELISA Kit
EGTA0526	Abclonal	96Tests	EUR 521

Canine APOE ELISA Kit
ECA0526	Abclonal	96Tests	EUR 521

Chicken APOE ELISA Kit
ECKA0526	Abclonal	96Tests	EUR 521

Bovine APOE ELISA Kit
EBA0526	Abclonal	96Tests	EUR 521

Anserini APOE ELISA Kit
EAA0526	Abclonal	96Tests	EUR 521

APOE ELISA KIT|Human
EF001196	Lifescience Market	96 Tests	EUR 689

Rat APOE ELISA Kit
ERA0526	Abclonal	96Tests	EUR 521

Rabbit APOE ELISA Kit
ERTA0526	Abclonal	96Tests	EUR 521

Sheep APOE ELISA Kit
ESA0526	Abclonal	96Tests	EUR 521

Porcine APOE ELISA Kit
EPA0526	Abclonal	96Tests	EUR 521

Mouse APOE ELISA Kit
EMA0526	Abclonal	96Tests	EUR 521

Monkey APOE ELISA Kit
EMKA0526	Abclonal	96Tests	EUR 521

Human ApoE ELISA Kit
STA-367	Cell Biolabs	96 assays	EUR 722
Description: The Human ApoE ELISA Kit is an enzyme immunoassay developed for the detection and quantitation of human apolipoprotein in plasma, serum or other biological fluid samples.  Each kit provides sufficient reagents to perform up to 96 assays including standard curve and unknown samples.

Human APOE ELISA Kit
STJ150123	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ApoE in human serum, plasma and other biological fluids

Mouse APOE ELISA Kit
STJ150264	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of APO-E in Mouse serum, plasma and other biological fluids

APOE siRNA
20-abx900378	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

APOE siRNA
20-abx907844	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

APOE siRNA
20-abx907845	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ApoE Antibody
BF0404	Affbiotech	200ul	EUR 376
Description: ApoE antibody detects endogenous levels of total ApoE.

ApoE antibody
70R-5264	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ApoE antibody raised against the N terminal of APOE

APOE Antibody
ABD4797	Lifescience Market	100 ug	EUR 438

APOE Antibody
35301-100ul	SAB	100ul	EUR 252

APOE Antibody
35301-50ul	SAB	50ul	EUR 187

ApoE antibody
10R-10633	Fitzgerald	100 ug	EUR 349
Description: Mouse monoclonal ApoE antibody

ApoE antibody
10R-A136a	Fitzgerald	50 ug	EUR 418
Description: Mouse monoclonal ApoE antibody

ApoE protein
30-1053	Fitzgerald	50 ug	EUR 1065
Description: Purified native Human ApoE protein

ApoE protein
30-AA30	Fitzgerald	100 ug	EUR 780
Description: Purified native Human ApoE protein

ApoE antibody
10R-2370	Fitzgerald	50 ug	EUR 405
Description: Mouse monoclonal Apolipoprotein E antibody

ApoE antibody
20-S1161G000-V0	Fitzgerald	10 ml	EUR 203
Description: Goat polyclonal ApoE antibody

ApoE antibody
70C-CR9016GAP	Fitzgerald	100 ug	EUR 137
Description: Affinity purified Goat polyclonal Apo E antibody

ApoE antibody
70C-CR90GAP	Fitzgerald	100 ug	EUR 241
Description: Purified Polyclonal Goat ApoE antibody

APOE Antibody
DF4797	Affbiotech	200ul	EUR 304
Description: APOE Antibody detects endogenous levels of total APOE.

Apoe Antibody
1-CSB-PA001936LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Apoe. Recognizes Apoe from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

APOE Antibody
CSB-PA227407-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against APOE. Recognizes APOE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

APOE Antibody
CSB-PA227407-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against APOE. Recognizes APOE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

APOE Antibody
1-CSB-PA009485	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APOE. Recognizes APOE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

APOE Antibody
1-CSB-PA009486	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APOE. Recognizes APOE from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

APOE Antibody
1-CSB-PA07599A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOE. Recognizes APOE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:1000-1:2000, IF:1:200-1:500

APOE antibody
PAab10127	Lifescience Market	100 ug	EUR 355

Human APOE PicoKine ELISA Kit
EK1455	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human APOE in cell culture supernates, serum, plasma(heparin, EDTA), saliva, milk and urine.

ELISA kit for Human APOE
EK5683	SAB	96 tests	EUR 519
Description: Enzyme-linked immunosorbent assay kit for quantification of Human APOE in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea Pig APOE ELISA Kit
EGA0526	Abclonal	96Tests	EUR 521

ApoE receptor ELISA KIT|Human
EF007481	Lifescience Market	96 Tests	EUR 689

APOE ELISA Kit (Human) (OKAN04532)
OKAN04532	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.8 ng/mL

APOE ELISA Kit (Mouse) (OKAN04694)
OKAN04694	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 ng/mL

APOE ELISA Kit (Rat) (OKAN05188)
OKAN05188	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: plays a role in plasma lipoprotein transport [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.92 ng/mL

APOE ELISA Kit (Dog) (OKCD06699)
OKCD06699	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Chylomicron remnants and very low density lipoprotein (VLDL) remnants are rapidly removed from the circulation by receptor-mediated endocytosis in the liver. Apolipoprotein E, a main apoprotein of the chylomicron, binds to a specific receptor on liver cells and peripheral cells. ApoE is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. The APOE gene is mapped to chromosome 19 in a cluster with APOC1 and APOC2. Defects in apolipoprotein E result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.;Species reactivity: Dog;Application: ELISA;Assay info: ;Sensitivity: < 0.65ng/mL

APOE ELISA Kit (Human) (OKCD06700)
OKCD06700	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: Chylomicron remnants and very low density lipoprotein (VLDL) remnants are rapidly removed from the circulation by receptor-mediated endocytosis in the liver. Apolipoprotein E, a main apoprotein of the chylomicron, binds to a specific receptor on liver cells and peripheral cells. ApoE is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Defects in apolipoprotein E result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.Chylomicron remnants and very low density lipoprotein (VLDL) remnants are rapidly removed from the circulation by receptor-mediated endocytosis in the liver. Apolipoprotein E, a main apoprotein of the chylomicron, binds to a specific receptor on liver cells and peripheral cells. ApoE is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. The APOE gene is mapped to chromosome 19 in a cluster with APOC1 and APOC2. Defects in apolipoprotein E result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 1.9ng/mL

APOE ELISA Kit (Mouse) (OKCD06701)
OKCD06701	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.7ng/mL

APOE ELISA Kit (Pig) (OKCD06702)
OKCD06702	Aviva Systems Biology	96 Wells	EUR 1040
Description: Description of target: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.;Species reactivity: Pig;Application: ELISA;Assay info: ;Sensitivity: < 0.142ng/mL

APOE ELISA Kit (Rat) (OKCD06703)
OKCD06703	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: plays a role in plasma lipoprotein transport.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.92ng/mL

APOE ELISA Kit (Rat) (OKEH03198)
OKEH03198	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Mediates the binding, internalization, and catabolism of lipoprotein particles. It can serve as a ligand for the LDL (apo B/E) receptor and for the specific apo-E receptor (chylomicron remnant) of hepatic tissues.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.97 ng/mL

APOE ELISA Kit (Mouse) (OKEH04368)
OKEH04368	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.96 ng/mL

APOE ELISA Kit (Human) (OKBB01004)
OKBB01004	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Apolipoprotein E (APOE) is a class of apolipoprotein found in the chylomicron and Intermediate-density lipoprotein (IDLs) that is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. In peripheral tissues, APOE is primarily produced by the liver and macrophages, and mediates cholesterol metabolism in an isoform- dependent manner. In the central nervous system, APOE is mainly produced by astrocytes, and transports cholesterol to neurons via APOE receptors, which are members of the low density lipoprotein receptor gene family. This protein is involved in Alzheimer’s disease and cardiovascular disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

APOE ELISA Kit (Monkey) (OKWB00288)
OKWB00288	Aviva Systems Biology	96 Wells	EUR 572
Description: Description of target: Mediates the binding, internalization, and catabolism of lipoprotein particles. It can serve as a ligand for the LDL (apo B/E) receptor and for the specific apo-E receptor (chylomicron remnant) of hepatic tissues.;Species reactivity: Monkey;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 3.75 ng/mL

ApoE Blocking Peptide
BF0404-BP	Affbiotech	1mg	EUR 195

APOE Conjugated Antibody
C35301	SAB	100ul	EUR 397

Apolipoprotein E/ApoE
E21-I02	EnoGene	10ug	EUR 343

anti- APOE antibody
FNab10127	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:2000 IHC: 1:50-1:200 IF: 1:50-1:200 Immunogen: apolipoprotein E 33B Uniprot ID: P02649 Gene ID: 348 Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biology, Neuroscience
Description: Antibody raised against APOE

ApoE Polyclonal Antibody
ES5846-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ApoE from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ApoE Polyclonal Antibody
ES5846-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ApoE from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ApoE Polyclonal Antibody
ES5847-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ApoE from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ApoE Polyclonal Antibody
ES5847-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ApoE from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ApoE Polyclonal Antibody
ABP54847-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human ApoE Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human, Mouse, Rat. This ApoE antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody
ABP54847-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human ApoE Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human, Mouse, Rat. This ApoE antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody
ABP54847-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human ApoE Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human, Mouse, Rat. This ApoE antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody
ABP54848-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human ApoE Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human. This ApoE antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody
ABP54848-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human ApoE Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human. This ApoE antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody
ABP54848-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human ApoE Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human. This ApoE antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

APOE Rabbit pAb
A0304-100ul	Abclonal	100 ul	EUR 308

APOE Rabbit pAb
A0304-200ul	Abclonal	200 ul	EUR 459

APOE Rabbit pAb
A0304-20ul	Abclonal	20 ul	EUR 183

APOE Rabbit pAb
A0304-50ul	Abclonal	50 ul	EUR 223

ApoE Rabbit pAb
A12400-100ul	Abclonal	100 ul	EUR 308

ApoE Rabbit pAb
A12400-200ul	Abclonal	200 ul	EUR 459

ApoE Rabbit pAb
A12400-20ul	Abclonal	20 ul	EUR 183

ApoE Rabbit pAb
A12400-50ul	Abclonal	50 ul	EUR 223

Apoe Polyclonal Antibody
A53280	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Apoe Rabbit pAb
A16344-100ul	Abclonal	100 ul	EUR 308

Apoe Rabbit pAb
A16344-200ul	Abclonal	200 ul	EUR 459

Apoe Rabbit pAb
A16344-20ul	Abclonal	20 ul	EUR 183

Apoe Rabbit pAb
A16344-50ul	Abclonal	50 ul	EUR 223

ApoE Blocking Peptide
33R-4716	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOE antibody, catalog no. 70R-5264

ApoE Polyclonal Antibody
40604-100ul	SAB	100ul	EUR 252

ApoE Polyclonal Antibody
40604-50ul	SAB	50ul	EUR 187

ApoE Antibody (CT)
6720-100	Biovision		EUR 316

APOE Blocking Peptide
DF4797-BP	Affbiotech	1mg	EUR 195

APOE cloning plasmid
CSB-CL001936HU-10ug	Cusabio	10ug	EUR 377
Formulation: 10 μg plasmid + 200μl Glycerol Length: 954 Sequence: atgaaggttctgtgggctgcgttgctggtcacattcctggcaggatgccaggccaaggtggagcaagcggtggagacagagccggagcccgagctgcgccagcagaccgagtggcagagcggccagcgctgggaactggcactgggtcgcttttgggattacctgcgctgggtgca Show more
Description: A cloning plasmid for the APOE gene.

ApoE R2, CF
PR15062CF	Neuromics	50 ug	EUR 461

anti-ApoE (1H4)
LF-MA30578	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to ApoE

pSV40- Apoe- m
PVT11521	Lifescience Market	2 ug	EUR 273

Anti-ApoE antibody
STJ91638	St John's Laboratory	200 µl	EUR 197
Description: ApoE is a protein encoded by the APOE gene which is approximately 36,1 kDa. ApoE is secreted and is involved in lipoprotein metabolism, the statin pathway, respiratory electron transport and glucose / energy metabolism. It is a major apoprotein of chylomicrons. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. ApoE is expressed in most organs. Significant quantities are produced in liver, brain, spleen, lung, adrenal, ovary, kidney and muscle. Mutations in the APOE gene may result in hyperlipoproteinemian. STJ91638 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of ApoE protein.

Anti-ApoE antibody
STJ91639	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to ApoE.

Anti-APOE antibody
STJ70680	St John's Laboratory	100 µg	EUR 359

Anti-ApoE antibody
STJ97839	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to ApoE.

Anti-ApoE antibody
STJ29789	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.

Anti-ApoE antibody
STJ114931	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.

Anti-APOE antibody
STJ118784	St John's Laboratory	100 µl	EUR 277

Rabbit Apolipoprotein E (APOE) ELISA Kit
CEA704Rb-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit
CEA704Rb-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit
CEA704Rb-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit
CEA704Rb-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit
4-CEA704Rb	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Apolipoprotein E elisa. Alternative names of the recognized antigen: Apo-E AD2 Apoprotein Alzheimer Disease 2(E4-Associated, Late Onset
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rabbit Apolipoprotein E (APOE) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Cow Apolipoprotein E (APOE) ELISA Kit
abx513773-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Apolipoprotein E (APOE) ELISA Kit
abx573448-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Apolipoprotein E (APOE) ELISA Kit
abx575113-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Apolipoprotein E (APOE) ELISA Kit
abx575214-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human APOE(Apolipoprotein E ) ELISA Kit
EH0549	FN Test	96T	EUR 476.25
Detection range: 1.25-80 ng/ml Uniprot ID: P02649 Alias: APOE(Apolipoprotein E)/Apo-E/MGC1571/apolipoprotein E3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.75 ng/ml

Bovine Apolipoprotein E, APOE ELISA KIT
ELI-02450b	Lifescience Market	96 Tests	EUR 928

Human Apolipoprotein E, APOE ELISA KIT
ELI-02451h	Lifescience Market	96 Tests	EUR 824

Mouse Apolipoprotein E, Apoe ELISA KIT
ELI-02452m	Lifescience Market	96 Tests	EUR 865

Porcine Apolipoprotein E, APOE ELISA KIT
ELI-02453p	Lifescience Market	96 Tests	EUR 928

Rabbit Apolipoprotein E, APOE ELISA KIT
ELI-02454Ra	Lifescience Market	96 Tests	EUR 928

Canine Apolipoprotein E, APOE ELISA KIT
ELI-02455d	Lifescience Market	96 Tests	EUR 928

Rat Apolipoprotein E, Apoe ELISA KIT
ELI-02456r	Lifescience Market	96 Tests	EUR 886

Rat Apoe(Apolipoprotein E) ELISA Kit
ER0353	FN Test	96T	EUR 476.25
Detection range: 3.125-200 ng/ml Uniprot ID: P02650 Alias: Apoe(Apolipoprotein E )/Apo-E/apolipoprotein E3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 1.875 ng/ml

Rabbit ApoE(Apolipoprotein E) ELISA Kit
ERB0014	FN Test	96T	EUR 567.6
Detection range: 0.625-40 ng/ml Uniprot ID: P18287 Alias: APO-E(Apolipoprotein E)/Apo-E/MGC1571/apolipoprotein E3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rabbit;Sensitivity: 0.375 ng/ml

These protein associations provide novel biological insights into the molecular mechanisms that are dysregulated prior to and following the onset of type 2 diabetes and can be detected in serum. A bi-directional two-sample Mendelian randomization analysis indicated that serum changes of at least 23 proteins are downstream of the disease or its genetic liability, while 15 proteins were supported as having a causal role in type 2 diabetes.