Circulating Protein Signatures and Causal Candidates for Type 2 Diabetes.

The increasing prevalence of type 2 diabetes poses a major challenge to societies worldwide. Blood-based factors like serum proteins are in contact with every organ in the body to mediate global homeostasis and may thus directly regulate complex processes such as aging and the development of common chronic diseases. We applied a data-driven proteomics approach, measuring serum levels of 4,137 proteins in 5,438 elderly Icelanders and identified 536 proteins associated with prevalent and/or incident type 2 diabetes. We validated a subset of the observed associations in an independent case-control study of type 2 diabetes.

Mouse Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Mu-48T 48T
EUR 489
  • Should the Mouse Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Mu-96T 96T
EUR 635
  • Should the Mouse Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-p-48T 48T
EUR 547
  • Should the Porcine Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Porcine Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-p-96T 96T
EUR 715
  • Should the Porcine Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Rat Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Ra-48T 48T
EUR 508
  • Should the Rat Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Ra-96T 96T
EUR 661
  • Should the Rat Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Rb-48T 48T
EUR 508
  • Should the Rabbit Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rabbit Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Rb-96T 96T
EUR 661
  • Should the Rabbit Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rabbit Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Hu-48Tests 48 Tests
EUR 436

Human Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Hu-96Tests 96 Tests
EUR 601

Mouse Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Mu-48Tests 48 Tests
EUR 489

Mouse Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Mu-96Tests 96 Tests
EUR 677

Porcine Apolipoprotein E (APOE) ELISA Kit

RD-APOE-p-48Tests 48 Tests
EUR 555

Porcine Apolipoprotein E (APOE) ELISA Kit

RD-APOE-p-96Tests 96 Tests
EUR 771

Rat Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Ra-48Tests 48 Tests
EUR 511

Rat Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Ra-96Tests 96 Tests
EUR 709

Rabbit Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Rb-48Tests 48 Tests
EUR 511

Rabbit Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Rb-96Tests 96 Tests
EUR 709

Human Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Hu-48Tests 48 Tests
EUR 455

Human Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Hu-96Tests 96 Tests
EUR 629

Mouse Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Mu-48Tests 48 Tests
EUR 511

Mouse Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Mu-96Tests 96 Tests
EUR 709

Porcine Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-p-48Tests 48 Tests
EUR 580

Porcine Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-p-96Tests 96 Tests
EUR 807

Rat Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Ra-48Tests 48 Tests
EUR 534

Rat Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Ra-96Tests 96 Tests
EUR 742

Rabbit Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Rb-48Tests 48 Tests
EUR 534

Rabbit Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Rb-96Tests 96 Tests
EUR 742

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

APOE

E62B009 20ug
EUR 382

ApoE

MO25042 100 ul
EUR 474

Human APOE ELISA Kit

EHA0526 96Tests
EUR 521

Human APOE ELISA Kit

ELA-E0704h 96 Tests
EUR 824

Goat APOE ELISA Kit

EGTA0526 96Tests
EUR 521

Canine APOE ELISA Kit

ECA0526 96Tests
EUR 521

Chicken APOE ELISA Kit

ECKA0526 96Tests
EUR 521

Bovine APOE ELISA Kit

EBA0526 96Tests
EUR 521

Anserini APOE ELISA Kit

EAA0526 96Tests
EUR 521

APOE ELISA KIT|Human

EF001196 96 Tests
EUR 689

Rat APOE ELISA Kit

ERA0526 96Tests
EUR 521

Rabbit APOE ELISA Kit

ERTA0526 96Tests
EUR 521

Sheep APOE ELISA Kit

ESA0526 96Tests
EUR 521

Porcine APOE ELISA Kit

EPA0526 96Tests
EUR 521

Mouse APOE ELISA Kit

EMA0526 96Tests
EUR 521

Monkey APOE ELISA Kit

EMKA0526 96Tests
EUR 521

Human ApoE ELISA Kit

STA-367 96 assays
EUR 722
Description: The Human ApoE ELISA Kit is an enzyme immunoassay developed for the detection and quantitation of human apolipoprotein in plasma, serum or other biological fluid samples.  Each kit provides sufficient reagents to perform up to 96 assays including standard curve and unknown samples.

Human APOE ELISA Kit

STJ150123 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ApoE in human serum, plasma and other biological fluids

Mouse APOE ELISA Kit

STJ150264 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of APO-E in Mouse serum, plasma and other biological fluids

APOE siRNA

20-abx900378
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APOE siRNA

20-abx907844
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APOE siRNA

20-abx907845
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ApoE Antibody

BF0404 200ul
EUR 376
Description: ApoE antibody detects endogenous levels of total ApoE.

ApoE antibody

70R-5264 50 ug
EUR 467
Description: Rabbit polyclonal ApoE antibody raised against the N terminal of APOE

APOE Antibody

ABD4797 100 ug
EUR 438

APOE Antibody

35301-100ul 100ul
EUR 252

APOE Antibody

35301-50ul 50ul
EUR 187

ApoE antibody

10R-10633 100 ug
EUR 349
Description: Mouse monoclonal ApoE antibody

ApoE antibody

10R-A136a 50 ug
EUR 418
Description: Mouse monoclonal ApoE antibody

ApoE protein

30-1053 50 ug
EUR 1065
Description: Purified native Human ApoE protein

ApoE protein

30-AA30 100 ug
EUR 780
Description: Purified native Human ApoE protein

ApoE antibody

10R-2370 50 ug
EUR 405
Description: Mouse monoclonal Apolipoprotein E antibody

ApoE antibody

20-S1161G000-V0 10 ml
EUR 203
Description: Goat polyclonal ApoE antibody

ApoE antibody

70C-CR9016GAP 100 ug
EUR 137
Description: Affinity purified Goat polyclonal Apo E antibody

ApoE antibody

70C-CR90GAP 100 ug
EUR 241
Description: Purified Polyclonal Goat ApoE antibody

APOE Antibody

DF4797 200ul
EUR 304
Description: APOE Antibody detects endogenous levels of total APOE.

Apoe Antibody

1-CSB-PA001936LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Apoe. Recognizes Apoe from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

APOE Antibody

CSB-PA227407-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against APOE. Recognizes APOE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

APOE Antibody

CSB-PA227407-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against APOE. Recognizes APOE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

APOE Antibody

1-CSB-PA009485
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APOE. Recognizes APOE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

APOE Antibody

1-CSB-PA009486
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APOE. Recognizes APOE from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

APOE Antibody

1-CSB-PA07599A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOE. Recognizes APOE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:1000-1:2000, IF:1:200-1:500

APOE antibody

PAab10127 100 ug
EUR 355

Human APOE PicoKine ELISA Kit

EK1455 96 wells
EUR 425
Description: For quantitative detection of human APOE in cell culture supernates, serum, plasma(heparin, EDTA), saliva, milk and urine.

ELISA kit for Human APOE

EK5683 96 tests
EUR 519
Description: Enzyme-linked immunosorbent assay kit for quantification of Human APOE in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea Pig APOE ELISA Kit

EGA0526 96Tests
EUR 521

ApoE receptor ELISA KIT|Human

EF007481 96 Tests
EUR 689

APOE ELISA Kit (Human) (OKAN04532)

OKAN04532 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.8 ng/mL

APOE ELISA Kit (Mouse) (OKAN04694)

OKAN04694 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 ng/mL

APOE ELISA Kit (Rat) (OKAN05188)

OKAN05188 96 Wells
EUR 792
Description: Description of target: plays a role in plasma lipoprotein transport [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.92 ng/mL

APOE ELISA Kit (Dog) (OKCD06699)

OKCD06699 96 Wells
EUR 1001
Description: Description of target: Chylomicron remnants and very low density lipoprotein (VLDL) remnants are rapidly removed from the circulation by receptor-mediated endocytosis in the liver. Apolipoprotein E, a main apoprotein of the chylomicron, binds to a specific receptor on liver cells and peripheral cells. ApoE is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. The APOE gene is mapped to chromosome 19 in a cluster with APOC1 and APOC2. Defects in apolipoprotein E result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.;Species reactivity: Dog;Application: ELISA;Assay info: ;Sensitivity: < 0.65ng/mL

APOE ELISA Kit (Human) (OKCD06700)

OKCD06700 96 Wells
EUR 596
Description: Description of target: Chylomicron remnants and very low density lipoprotein (VLDL) remnants are rapidly removed from the circulation by receptor-mediated endocytosis in the liver. Apolipoprotein E, a main apoprotein of the chylomicron, binds to a specific receptor on liver cells and peripheral cells. ApoE is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Defects in apolipoprotein E result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.Chylomicron remnants and very low density lipoprotein (VLDL) remnants are rapidly removed from the circulation by receptor-mediated endocytosis in the liver. Apolipoprotein E, a main apoprotein of the chylomicron, binds to a specific receptor on liver cells and peripheral cells. ApoE is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. The APOE gene is mapped to chromosome 19 in a cluster with APOC1 and APOC2. Defects in apolipoprotein E result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 1.9ng/mL

APOE ELISA Kit (Mouse) (OKCD06701)

OKCD06701 96 Wells
EUR 779
Description: Description of target: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.7ng/mL

APOE ELISA Kit (Pig) (OKCD06702)

OKCD06702 96 Wells
EUR 1040
Description: Description of target: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.;Species reactivity: Pig;Application: ELISA;Assay info: ;Sensitivity: < 0.142ng/mL

APOE ELISA Kit (Rat) (OKCD06703)

OKCD06703 96 Wells
EUR 818
Description: Description of target: plays a role in plasma lipoprotein transport.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.92ng/mL

APOE ELISA Kit (Rat) (OKEH03198)

OKEH03198 96 Wells
EUR 662
Description: Description of target: Mediates the binding, internalization, and catabolism of lipoprotein particles. It can serve as a ligand for the LDL (apo B/E) receptor and for the specific apo-E receptor (chylomicron remnant) of hepatic tissues.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.97 ng/mL

APOE ELISA Kit (Mouse) (OKEH04368)

OKEH04368 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.96 ng/mL

APOE ELISA Kit (Human) (OKBB01004)

OKBB01004 96 Wells
EUR 505
Description: Description of target: Apolipoprotein E (APOE) is a class of apolipoprotein found in the chylomicron and Intermediate-density lipoprotein (IDLs) that is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. In peripheral tissues, APOE is primarily produced by the liver and macrophages, and mediates cholesterol metabolism in an isoform- dependent manner. In the central nervous system, APOE is mainly produced by astrocytes, and transports cholesterol to neurons via APOE receptors, which are members of the low density lipoprotein receptor gene family. This protein is involved in Alzheimer’s disease and cardiovascular disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

APOE ELISA Kit (Monkey) (OKWB00288)

OKWB00288 96 Wells
EUR 572
Description: Description of target: Mediates the binding, internalization, and catabolism of lipoprotein particles. It can serve as a ligand for the LDL (apo B/E) receptor and for the specific apo-E receptor (chylomicron remnant) of hepatic tissues.;Species reactivity: Monkey;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 3.75 ng/mL

ApoE Blocking Peptide

BF0404-BP 1mg
EUR 195

APOE Conjugated Antibody

C35301 100ul
EUR 397

Apolipoprotein E/ApoE

E21-I02 10ug
EUR 343

anti- APOE antibody

FNab10127 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:50-1:200
  • IF: 1:50-1:200
  • Immunogen: apolipoprotein E 33B
  • Uniprot ID: P02649
  • Gene ID: 348
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biology, Neuroscience
Description: Antibody raised against APOE

ApoE Polyclonal Antibody

ES5846-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ApoE from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ApoE Polyclonal Antibody

ES5846-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ApoE from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ApoE Polyclonal Antibody

ES5847-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ApoE from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ApoE Polyclonal Antibody

ES5847-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ApoE from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ApoE Polyclonal Antibody

ABP54847-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoE
  • Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human, Mouse, Rat. This ApoE antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody

ABP54847-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoE
  • Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human, Mouse, Rat. This ApoE antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody

ABP54847-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoE
  • Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human, Mouse, Rat. This ApoE antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody

ABP54848-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoE
  • Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human. This ApoE antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody

ABP54848-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoE
  • Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human. This ApoE antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

ApoE Polyclonal Antibody

ABP54848-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoE
  • Applications tips:
Description: A polyclonal antibody for detection of ApoE from Human. This ApoE antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoE

APOE Rabbit pAb

A0304-100ul 100 ul
EUR 308

APOE Rabbit pAb

A0304-200ul 200 ul
EUR 459

APOE Rabbit pAb

A0304-20ul 20 ul
EUR 183

APOE Rabbit pAb

A0304-50ul 50 ul
EUR 223

ApoE Rabbit pAb

A12400-100ul 100 ul
EUR 308

ApoE Rabbit pAb

A12400-200ul 200 ul
EUR 459

ApoE Rabbit pAb

A12400-20ul 20 ul
EUR 183

ApoE Rabbit pAb

A12400-50ul 50 ul
EUR 223

Apoe Polyclonal Antibody

A53280 100 µg
EUR 570.55
Description: The best epigenetics products

Apoe Rabbit pAb

A16344-100ul 100 ul
EUR 308

Apoe Rabbit pAb

A16344-200ul 200 ul
EUR 459

Apoe Rabbit pAb

A16344-20ul 20 ul
EUR 183

Apoe Rabbit pAb

A16344-50ul 50 ul
EUR 223

ApoE Blocking Peptide

33R-4716 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOE antibody, catalog no. 70R-5264

ApoE Polyclonal Antibody

40604-100ul 100ul
EUR 252

ApoE Polyclonal Antibody

40604-50ul 50ul
EUR 187

ApoE Antibody (CT)

6720-100
EUR 316

APOE Blocking Peptide

DF4797-BP 1mg
EUR 195

APOE cloning plasmid

CSB-CL001936HU-10ug 10ug
EUR 377
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 954
  • Sequence: atgaaggttctgtgggctgcgttgctggtcacattcctggcaggatgccaggccaaggtggagcaagcggtggagacagagccggagcccgagctgcgccagcagaccgagtggcagagcggccagcgctgggaactggcactgggtcgcttttgggattacctgcgctgggtgca
  • Show more
Description: A cloning plasmid for the APOE gene.

ApoE R2, CF

PR15062CF 50 ug
EUR 461

anti-ApoE (1H4)

LF-MA30578 100 ul
EUR 527
Description: Mouse Monoclonal to ApoE

pSV40- Apoe- m

PVT11521 2 ug
EUR 273

Anti-ApoE antibody

STJ91638 200 µl
EUR 197
Description: ApoE is a protein encoded by the APOE gene which is approximately 36,1 kDa. ApoE is secreted and is involved in lipoprotein metabolism, the statin pathway, respiratory electron transport and glucose / energy metabolism. It is a major apoprotein of chylomicrons. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. ApoE is expressed in most organs. Significant quantities are produced in liver, brain, spleen, lung, adrenal, ovary, kidney and muscle. Mutations in the APOE gene may result in hyperlipoproteinemian. STJ91638 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of ApoE protein.

Anti-ApoE antibody

STJ91639 200 µl
EUR 197
Description: Rabbit polyclonal to ApoE.

Anti-APOE antibody

STJ70680 100 µg
EUR 359

Anti-ApoE antibody

STJ97839 100 µl
EUR 234
Description: Mouse monoclonal to ApoE.

Anti-ApoE antibody

STJ29789 100 µl
EUR 277
Description: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.

Anti-ApoE antibody

STJ114931 100 µl
EUR 277
Description: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants.

Anti-APOE antibody

STJ118784 100 µl
EUR 277

Rabbit Apolipoprotein E (APOE) ELISA Kit

CEA704Rb-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

CEA704Rb-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

CEA704Rb-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

CEA704Rb-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

4-CEA704Rb
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein E elisa. Alternative names of the recognized antigen: Apo-E
  • AD2
  • Apoprotein
  • Alzheimer Disease 2(E4-Associated, Late Onset
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rabbit Apolipoprotein E (APOE) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Cow Apolipoprotein E (APOE) ELISA Kit

abx513773-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Apolipoprotein E (APOE) ELISA Kit

abx573448-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Apolipoprotein E (APOE) ELISA Kit

abx575113-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Apolipoprotein E (APOE) ELISA Kit

abx575214-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human APOE(Apolipoprotein E ) ELISA Kit

EH0549 96T
EUR 476.25
  • Detection range: 1.25-80 ng/ml
  • Uniprot ID: P02649
  • Alias: APOE(Apolipoprotein E)/Apo-E/MGC1571/apolipoprotein E3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.75 ng/ml

Bovine Apolipoprotein E, APOE ELISA KIT

ELI-02450b 96 Tests
EUR 928

Human Apolipoprotein E, APOE ELISA KIT

ELI-02451h 96 Tests
EUR 824

Mouse Apolipoprotein E, Apoe ELISA KIT

ELI-02452m 96 Tests
EUR 865

Porcine Apolipoprotein E, APOE ELISA KIT

ELI-02453p 96 Tests
EUR 928

Rabbit Apolipoprotein E, APOE ELISA KIT

ELI-02454Ra 96 Tests
EUR 928

Canine Apolipoprotein E, APOE ELISA KIT

ELI-02455d 96 Tests
EUR 928

Rat Apolipoprotein E, Apoe ELISA KIT

ELI-02456r 96 Tests
EUR 886

Rat Apoe(Apolipoprotein E) ELISA Kit

ER0353 96T
EUR 476.25
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P02650
  • Alias: Apoe(Apolipoprotein E )/Apo-E/apolipoprotein E3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 1.875 ng/ml

Rabbit ApoE(Apolipoprotein E) ELISA Kit

ERB0014 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P18287
  • Alias: APO-E(Apolipoprotein E)/Apo-E/MGC1571/apolipoprotein E3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rabbit;Sensitivity: 0.375 ng/ml

These protein associations provide novel biological insights into the molecular mechanisms that are dysregulated prior to and following the onset of type 2 diabetes and can be detected in serum. A bi-directional two-sample Mendelian randomization analysis indicated that serum changes of at least 23 proteins are downstream of the disease or its genetic liability, while 15 proteins were supported as having a causal role in type 2 diabetes.